Data Formats

1. RNA (.rna):

   Two lines: a sequence of bases in the first line, and a dot-bracket representation of the base pairs in the second line. Individual RNA files can be extracted from the file pseudobase.fasta.
   Example:

   CGGUCAUAAGAGAUAAGCUAGCGUCCUAAUCUAUCCCGGGUUAUGGCGCGAAACUCAGGGA
   (((((((((::::::::::::::::::::::::[[[[[[[))))))):)):::]]]:]]]]
   

2. Sequence (.seq):

   A sequence of bases in one line, as in the first line of the RNA file.
   Example:

   CGGUCAUAAGAGAUAAGCUAGCGUCCUAAUCUAUCCCGGGUUAUGGCGCGAAACUCAGGGA
   

3. Dot-brackets (.db):

   A sequence of dots (colons) and brackets (parentheses, square brackets, and curly braces) that represent the base pairs, as in the second line of the RNA file.
   Example:

   (((((((((::::::::::::::::::::::::[[[[[[[))))))):)):::]]]:]]]]
   

4. Base pairs (.bp):

   A file consists of multiple lines. Each line consists of two numbers separated by a space. The two numbers are the indices of the two bases forming a base pair (the first base in the RNA sequence has index 1).
   Example:

   11 32
   12 31
   13 30
   14 29
   21 49
   22 48
   23 47
   24 46
   25 45
   34 61
   35 60
   36 59
   37 58
   

5. Helices (.hx):

   A compact representation of base pairs in multiple lines. Each line consists of three numbers separated by spaces: the first two numbers are the indices of the outer-most base pair in the helix; the third number is the helix length, that is, the number of base pairs in the helix.
   Example:

   11 32 4
   21 49 5
   34 61 4
   

6. Lattice conformation (.seq2):

   A sequence of bases and a sequence of turn directions. The two sequences are separated by an empty line. The number of turns is exactly the number of bases minus one.
   Example:

   CGGUCAUAAGAGAUAAGCUAGCGUCCUAAUCUAUCCCGGGUUAUGGCGCGAAACUCAGGGA
   
   zvXVUyxyZWYxVVZwzwYuuWXXvZXZvyXYYwwuZxzzVZXVYxyyuuXvyZXUzXWX
   

7. BPSEQ (.bpseq):

   A file consists of multiple lines, one line for each base in the sequence. Each line contains three fields: the index, the base, and the index to the other base in the pair (zero means unpaired).
   Example:

   1 C 0
   2 G 0
   3 G 0
   4 U 0
   5 C 0
   6 A 0
   7 U 0
   8 A 0
   9 A 0
   10 G 0
   11 A 32
   12 G 31
   13 A 30
   14 U 29
   15 A 0
   16 A 0
   17 G 0
   18 C 0
   19 U 0
   20 A 0
   21 G 49
   22 C 48
   23 G 47
   24 U 46
   25 C 45
   26 C 0
   27 U 0
   28 A 0
   29 A 14
   30 U 13
   31 C 12
   32 U 11
   33 A 0
   34 U 61
   35 C 60
   36 C 59
   37 C 58
   38 G 0
   39 G 0
   40 G 0
   41 U 0
   42 U 0
   43 A 0
   44 U 0
   45 G 25
   46 G 24
   47 C 23
   48 G 22
   49 C 21
   50 G 0
   51 A 0
   52 A 0
   53 A 0
   54 C 0
   55 U 0
   56 C 0
   57 A 0
   58 G 37
   59 G 36
   60 G 35
   61 A 34
   

8. Helices as 2-intervals (.hx2i):

   A textual representation of helices.
   Example:

             ____              ____
                       _____                   _____
                                    ____                    ____
   

_